In the present study Plackett

In the present study, Plackett–Burman experimental design was applied to screen the suitable operational parameters followed by RSM based on Box–Behnken design matrix for the optimization of biosorption process using immobilized bacterial ZJ 43 viz. Pseudomonas alcaligenes RJB-B and Pseudomonas resinovorans RJB-3 wherein the interactive effect of the most significant operating variables: pH, initial As(V) concentration and mixing speed were evaluated for removal of As(V) from aqueous solution. Moreover, the kinetics and mechanism of As(V) adsorption based on FTIR (Fourier transform infrared spectroscopy) and EDX (Energy-dispersive X-ray spectroscopy) analysis were also investigated. Although there are several reports on optimization of process parameters based on Plackett–Burman and RSM, but to best of our knowledge application of Plackett–Burman along with RSM based on Box–Behnken design for optimization of arsenate removal from aqueous system using immobilized bacterial biomass is not yet reported.

Some previous research has demonstrated that urban

Some previous research has demonstrated that urban ponds could exhibit thermal or chemical stratification (Kayombo et al., 2002 and McEnroe et al., 2013), which developed primarily due to low wind AS-1404 inputs, vertical gradients of water temperature and turbid water columns (Mazumder et al., 1990, Mazumder and Taylor, 1994 and Marsalek et al., 2000). Given the small surface area and sheltered location of the target pond, surface heating can outpace the redistribution of heat by vertical mixing driven by the wind and lead to thermal separated layers (Mazumder and Taylor, 1994 and Xenopoulos and Schindler, 2001). In eutrophic ponds, the redistribution of heat could be further reduced by the attenuation of light due to the high densities of phytoplankton in the surface (Mazumder et al., 1990, Weyhenmeyer, 1996 and Diehl et al., 2002). Both in summer and autumn, our study pond developed high density of microalgae in the surface, which could reduce vertical heat transfer from surface to bottom waters (Chiandet and Xenopoulos, 2011). Higher near-surface temperatures and the presence of a thermocline tended to prohibit mixing between bottom layer (hypolimnion) and surface layer (epilimnion). Such thermal stratification vertically separated phytoplankton biomass accrual in the target pond (Fig. 5). In poorly mixed water columns, algae have been found to be distributed heterogeneously with depths or might aggregate into a thin layer (Gentien et al., 2005 and Durham and Stocker, 2012). All of these can result in the variation of physical, chemical and biological parameters in vertical profile (Soler et al., 1991 and Gu and Stefan, 1995).

In the diets of bass in the

In 2010, Brefeldin A diets of bass in the realignment were dominated by harpacticoid copepods, with palaemonids and gammarids also consumed; insufficient fish were captured from the estuary for analysis of diet composition (Fig. 5a). In 2011, bass in the realignment preyed mainly upon oligochaetes, mysids and corophiids, while mysids and corophiids dominated diets in the estuary (Fig. 5a). Corophiids dominated the diets of bass in both the realignment and estuary in 2012, with small amounts of mysids also consumed in both habitats (Fig. 5a). In 2013, bass in the realignment preyed mainly upon corophiids and polychaetes, although mysids, oligochaetes and harpacticoid copepods were also consumed; insufficient fish were captured from the arrector pili estuary for analysis (Fig. 5a). Corophiids were the main prey of bass in the estuary in 2014, whereas corophiids, polychaetes and mysids were consumed in the realignment (Fig. 5a). There were no consistent differences in the diets of bass in the realignment and estuary (PERMANOVA, d.f. = 1, F = 1.741, P = 0.184), although the mean relative abundances of polychaetes, harpacticoid copepods and oligochaetes were higher in the realignment than the estuary, whereas corophiids were more abundant in the estuary (Table 3).

Stem loop qRT PCR analysis was employed

Stem loop qRT-PCR analysis was employed to validate and determine the specific VX-702 of pm-miRNAs with 5.8S as the internal control (Kolachala et al., 2010). Stem-loop RT primers, real-time PCR primers were designed as previously described (Chen et al., 2005a). All the primers used in this study are listed in Table 1. The relative expression of mature pm-miRNAs was calculated with the 2(Δct), and the relative expression of primary miRNAs was represented with reads per kilo bases per million reads (RPKM) calculated by reads in pearl sac transcriptome.
Table 1.
Sequences of mutation primers for stem-loop RT-PCR.
Name RT primer qPCR-antisense primer qPCR-sense primer
pm-miR-765 GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACCACCTCCT TGCGTGTCGTGGAGTC GGAGGAGAAGGAGGAG
pm-miR-669n GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACACACACAT TGCGTGTCGTGGAGTC ATTTGTGTGTGTTATGTGTGT
pm-miR-205b GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACCAGAGGCC TGCGTGTCGTGGAGTC ACCTTCATTCCACCGGCCTC